<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>https://wiki.csi.cuny.edu/cunyhpc/index.php?action=history&amp;feed=atom&amp;title=MRBAYES</id>
	<title>MRBAYES - Revision history</title>
	<link rel="self" type="application/atom+xml" href="https://wiki.csi.cuny.edu/cunyhpc/index.php?action=history&amp;feed=atom&amp;title=MRBAYES"/>
	<link rel="alternate" type="text/html" href="https://wiki.csi.cuny.edu/cunyhpc/index.php?title=MRBAYES&amp;action=history"/>
	<updated>2026-05-18T21:36:12Z</updated>
	<subtitle>Revision history for this page on the wiki</subtitle>
	<generator>MediaWiki 1.38.4</generator>
	<entry>
		<id>https://wiki.csi.cuny.edu/cunyhpc/index.php?title=MRBAYES&amp;diff=125&amp;oldid=prev</id>
		<title>James: Text replacement - &quot;[pP][bB][sS]&quot; to &quot;SLURM&quot;</title>
		<link rel="alternate" type="text/html" href="https://wiki.csi.cuny.edu/cunyhpc/index.php?title=MRBAYES&amp;diff=125&amp;oldid=prev"/>
		<updated>2022-10-27T19:33:01Z</updated>

		<summary type="html">&lt;p&gt;Text replacement - &amp;quot;[pP][bB][sS]&amp;quot; to &amp;quot;SLURM&amp;quot;&lt;/p&gt;
&lt;table style=&quot;background-color: #fff; color: #202122;&quot; data-mw=&quot;interface&quot;&gt;
				&lt;col class=&quot;diff-marker&quot; /&gt;
				&lt;col class=&quot;diff-content&quot; /&gt;
				&lt;col class=&quot;diff-marker&quot; /&gt;
				&lt;col class=&quot;diff-content&quot; /&gt;
				&lt;tr class=&quot;diff-title&quot; lang=&quot;en&quot;&gt;
				&lt;td colspan=&quot;2&quot; style=&quot;background-color: #fff; color: #202122; text-align: center;&quot;&gt;← Older revision&lt;/td&gt;
				&lt;td colspan=&quot;2&quot; style=&quot;background-color: #fff; color: #202122; text-align: center;&quot;&gt;Revision as of 19:33, 27 October 2022&lt;/td&gt;
				&lt;/tr&gt;&lt;tr&gt;&lt;td colspan=&quot;2&quot; class=&quot;diff-lineno&quot; id=&quot;mw-diff-left-l46&quot;&gt;Line 46:&lt;/td&gt;
&lt;td colspan=&quot;2&quot; class=&quot;diff-lineno&quot;&gt;Line 46:&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&amp;lt;/pre&amp;gt;&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&amp;lt;/pre&amp;gt;&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;br/&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;br/&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot; data-marker=&quot;−&quot;&gt;&lt;/td&gt;&lt;td style=&quot;color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;A &lt;del style=&quot;font-weight: bold; text-decoration: none;&quot;&gt;PBS &lt;/del&gt;Pro batch script must be created to run your job.  The first script below shows a MPI parallel run&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot; data-marker=&quot;+&quot;&gt;&lt;/td&gt;&lt;td style=&quot;color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;A &lt;ins style=&quot;font-weight: bold; text-decoration: none;&quot;&gt;SLURM &lt;/ins&gt;Pro batch script must be created to run your job.  The first script below shows a MPI parallel run&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot; data-marker=&quot;−&quot;&gt;&lt;/td&gt;&lt;td style=&quot;color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;of the above &amp;#039;.nex&amp;#039; input file.  This script selects 4 processors (cores) and allows &lt;del style=&quot;font-weight: bold; text-decoration: none;&quot;&gt;PBS &lt;/del&gt;to put them on any&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot; data-marker=&quot;+&quot;&gt;&lt;/td&gt;&lt;td style=&quot;color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;of the above &amp;#039;.nex&amp;#039; input file.  This script selects 4 processors (cores) and allows &lt;ins style=&quot;font-weight: bold; text-decoration: none;&quot;&gt;SLURM &lt;/ins&gt;to put them on any&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;compute node.  Note, that when running any parallel program one must be cognizant of the scaling  &lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;compute node.  Note, that when running any parallel program one must be cognizant of the scaling  &lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;properties of its parallel algorithm; in other words, how much does a given job&amp;#039;s running time drop&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;properties of its parallel algorithm; in other words, how much does a given job&amp;#039;s running time drop&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td colspan=&quot;2&quot; class=&quot;diff-lineno&quot; id=&quot;mw-diff-left-l91&quot;&gt;Line 91:&lt;/td&gt;
&lt;td colspan=&quot;2&quot; class=&quot;diff-lineno&quot;&gt;Line 91:&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;This test case should take no more than a couple of minutes to run and will produce SLURM output and&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;This test case should take no more than a couple of minutes to run and will produce SLURM output and&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;error files beginning with the job name &amp;#039;MRBAYES_mpi&amp;#039;.  Other MrBayes specific outputs will also be&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;error files beginning with the job name &amp;#039;MRBAYES_mpi&amp;#039;.  Other MrBayes specific outputs will also be&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot; data-marker=&quot;−&quot;&gt;&lt;/td&gt;&lt;td style=&quot;color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;produced.  Details on the meaning of the &lt;del style=&quot;font-weight: bold; text-decoration: none;&quot;&gt;PBS &lt;/del&gt;script are covered above in this Wiki&amp;#039;s SLURM section.  The&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot; data-marker=&quot;+&quot;&gt;&lt;/td&gt;&lt;td style=&quot;color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;produced.  Details on the meaning of the &lt;ins style=&quot;font-weight: bold; text-decoration: none;&quot;&gt;SLURM &lt;/ins&gt;script are covered above in this Wiki&amp;#039;s SLURM section.  The&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;most important lines are &amp;#039;#SBATCH --nodes=4 ntasks=1 mem=1920&amp;#039;.  The  &lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;most important lines are &amp;#039;#SBATCH --nodes=4 ntasks=1 mem=1920&amp;#039;.  The  &lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;first instructs SLURM to select 4 resource &amp;#039;chunks&amp;#039; each with 1 processor (core) and 1,920 MBs of memory&lt;/div&gt;&lt;/td&gt;&lt;td class=&quot;diff-marker&quot;&gt;&lt;/td&gt;&lt;td style=&quot;background-color: #f8f9fa; color: #202122; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #eaecf0; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;first instructs SLURM to select 4 resource &amp;#039;chunks&amp;#039; each with 1 processor (core) and 1,920 MBs of memory&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;/table&gt;</summary>
		<author><name>James</name></author>
	</entry>
	<entry>
		<id>https://wiki.csi.cuny.edu/cunyhpc/index.php?title=MRBAYES&amp;diff=92&amp;oldid=prev</id>
		<title>James: Created page with &quot;MrBayes is installed on ANDY and PENZIAS (GPU enabled version). In order to  set-up the environment required to run MrBayes corresponding module needs to be loaded first. This is done with   &lt;pre&gt; module load mrbayes &lt;/pre&gt;  Running MrBayes is a two-step process that first requires the creation of the NEXUS-formatted MrBayes input file and then the SLURM Pro script to run it.  MrBayes can be run in serial, MPI-parallel, or GPU-accelerated mode (on PENZIAS only).  Here is...&quot;</title>
		<link rel="alternate" type="text/html" href="https://wiki.csi.cuny.edu/cunyhpc/index.php?title=MRBAYES&amp;diff=92&amp;oldid=prev"/>
		<updated>2022-10-20T20:10:41Z</updated>

		<summary type="html">&lt;p&gt;Created page with &amp;quot;MrBayes is installed on ANDY and PENZIAS (GPU enabled version). In order to  set-up the environment required to run MrBayes corresponding module needs to be loaded first. This is done with   &amp;lt;pre&amp;gt; module load mrbayes &amp;lt;/pre&amp;gt;  Running MrBayes is a two-step process that first requires the creation of the NEXUS-formatted MrBayes input file and then the SLURM Pro script to run it.  MrBayes can be run in serial, MPI-parallel, or GPU-accelerated mode (on PENZIAS only).  Here is...&amp;quot;&lt;/p&gt;
&lt;p&gt;&lt;b&gt;New page&lt;/b&gt;&lt;/p&gt;&lt;div&gt;MrBayes is installed on ANDY and PENZIAS (GPU enabled version). In order to &lt;br /&gt;
set-up the environment required to run MrBayes corresponding module needs to be loaded first. This is done with &lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
module load mrbayes&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Running MrBayes is a two-step process that first requires the creation of the&lt;br /&gt;
NEXUS-formatted MrBayes input file and then the SLURM Pro script to run it.  MrBayes can be&lt;br /&gt;
run in serial, MPI-parallel, or GPU-accelerated mode (on PENZIAS only).&lt;br /&gt;
&lt;br /&gt;
Here is NEXUS input file (&amp;#039;&amp;#039;&amp;#039;primates.nex&amp;#039;&amp;#039;&amp;#039;) which includes both a DATA block and a MRBAYES block.&lt;br /&gt;
The MRBAYES block simply contains the MrBayes runtime commands terminated with a semi-colon.&lt;br /&gt;
The example below shows 12 mitochondrial DNA sequences of primates and yields at least 1,000&lt;br /&gt;
samples from the posterior probability distribution. If you need more detail on generating&lt;br /&gt;
the NEXUS file or on MrBayes in general, please check the MrBayes Wiki here [http://mrbayes.sourceforge.net]&lt;br /&gt;
and the online manual here [http://mrbayes.scs.fsu.edu/wiki/index.php/Main_Page on-line manual].&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
#NEXUS&lt;br /&gt;
&lt;br /&gt;
begin data;&lt;br /&gt;
dimensions ntax=12 nchar=898;&lt;br /&gt;
format datatype=dna interleave=no gap=-;&lt;br /&gt;
matrix&lt;br /&gt;
Tarsius_syrichta	AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTATTATTTTGCCTAGCAAATACAAACTACGAACGAGTCCACAGTCGAACAATAGCACTAGCCCGTGGCCTTCAAACCCTATTACCTCTTGCAGCAACATGATGACTCCTCGCCAGCTTAACCAACCTGGCCCTTCCCCCAACAATTAATTTAATCGGTGAACTGTCCGTAATAATAGCAGCATTTTCATGGTCACACCTAACTATTATCTTAGTAGGCCTTAACACCCTTATCACCGCCCTATATTCCCTATATATACTAATCATAACTCAACGAGGAAAATACACATATCATATCAACAATATCATGCCCCCTTTCACCCGAGAAAATACATTAATAATCATACACCTATTTCCCTTAATCCTACTATCTACCAACCCCAAAGTAATTATAGGAACCATGTACTGTAAATATAGTTTAAACAAAACATTAGATTGTGAGTCTAATAATAGAAGCCCAAAGATTTCTTATTTACCAAGAAAGTA-TGCAAGAACTGCTAACTCATGCCTCCATATATAACAATGTGGCTTTCTT-ACTTTTAAAGGATAGAAGTAATCCATCGGTCTTAGGAACCGAAAA-ATTGGTGCAACTCCAAATAAAAGTAATAAATTTATTTTCATCCTCCATTTTACTATCACTTACACTCTTAATTACCCCATTTATTATTACAACAACTAAAAAATATGAAACACATGCATACCCTTACTACGTAAAAAACTCTATCGCCTGCGCATTTATAACAAGCCTAGTCCCAATGCTCATATTTCTATACACAAATCAAGAAATAATCATTTCCAACTGACATTGAATAACGATTCATACTATCAAATTATGCCTAAGCTT&lt;br /&gt;
Lemur_catta		AAGCTTCATAGGAGCAACCATTCTAATAATCGCACATGGCCTTACATCATCCATATTATTCTGTCTAGCCAACTCTAACTACGAACGAATCCATAGCCGTACAATACTACTAGCACGAGGGATCCAAACCATTCTCCCTCTTATAGCCACCTGATGACTACTCGCCAGCCTAACTAACCTAGCCCTACCCACCTCTATCAATTTAATTGGCGAACTATTCGTCACTATAGCATCCTTCTCATGATCAAACATTACAATTATCTTAATAGGCTTAAATATGCTCATCACCGCTCTCTATTCCCTCTATATATTAACTACTACACAACGAGGAAAACTCACATATCATTCGCACAACCTAAACCCATCCTTTACACGAGAAAACACCCTTATATCCATACACATACTCCCCCTTCTCCTATTTACCTTAAACCCCAAAATTATTCTAGGACCCACGTACTGTAAATATAGTTTAAA-AAAACACTAGATTGTGAATCCAGAAATAGAAGCTCAAAC-CTTCTTATTTACCGAGAAAGTAATGTATGAACTGCTAACTCTGCACTCCGTATATAAAAATACGGCTATCTCAACTTTTAAAGGATAGAAGTAATCCATTGGCCTTAGGAGCCAAAAA-ATTGGTGCAACTCCAAATAAAAGTAATAAATCTATTATCCTCTTTCACCCTTGTCACACTGATTATCCTAACTTTACCTATCATTATAAACGTTACAAACATATACAAAAACTACCCCTATGCACCATACGTAAAATCTTCTATTGCATGTGCCTTCATCACTAGCCTCATCCCAACTATATTATTTATCTCCTCAGGACAAGAAACAATCATTTCCAACTGACATTGAATAACAATCCAAACCCTAAAACTATCTATTAGCTT&lt;br /&gt;
Homo_sapiens		AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTA-CGACCCCTTATTTACCGAGAAAGCT-CACAAGAACTGCTAACTCATGCCCCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTT&lt;br /&gt;
Pan	  		AAGCTTCACCGGCGCAATTATCCTCATAATCGCCCACGGACTTACATCCTCATTATTATTCTGCCTAGCAAACTCAAATTATGAACGCACCCACAGTCGCATCATAATTCTCTCCCAAGGACTTCAAACTCTACTCCCACTAATAGCCTTTTGATGACTCCTAGCAAGCCTCGCTAACCTCGCCCTACCCCCTACCATTAATCTCCTAGGGGAACTCTCCGTGCTAGTAACCTCATTCTCCTGATCAAATACCACTCTCCTACTCACAGGATTCAACATACTAATCACAGCCCTGTACTCCCTCTACATGTTTACCACAACACAATGAGGCTCACTCACCCACCACATTAATAACATAAAGCCCTCATTCACACGAGAAAATACTCTCATATTTTTACACCTATCCCCCATCCTCCTTCTATCCCTCAATCCTGATATCATCACTGGATTCACCTCCTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTCA-CGACCCCTTATTTACCGAGAAAGCT-TATAAGAACTGCTAATTCATATCCCCATGCCTGACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCCATCCGTTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGTATACTACCATAACCACCTTAACCCTAACTCCCTTAATTCTCCCCATCCTCACCACCCTCATTAACCCTAACAAAAAAAACTCATATCCCCATTATGTGAAATCCATTATCGCGTCCACCTTTATCATTAGCCTTTTCCCCACAACAATATTCATATGCCTAGACCAAGAAGCTATTATCTCAAACTGGCACTGAGCAACAACCCAAACAACCCAGCTCTCCCTAAGCTT&lt;br /&gt;
Gorilla   		AAGCTTCACCGGCGCAGTTGTTCTTATAATTGCCCACGGACTTACATCATCATTATTATTCTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGCATCATAATTCTCTCTCAAGGACTCCAAACCCTACTCCCACTAATAGCCCTTTGATGACTTCTGGCAAGCCTCGCCAACCTCGCCTTACCCCCCACCATTAACCTACTAGGAGAGCTCTCCGTACTAGTAACCACATTCTCCTGATCAAACACCACCCTTTTACTTACAGGATCTAACATACTAATTACAGCCCTGTACTCCCTTTATATATTTACCACAACACAATGAGGCCCACTCACACACCACATCACCAACATAAAACCCTCATTTACACGAGAAAACATCCTCATATTCATGCACCTATCCCCCATCCTCCTCCTATCCCTCAACCCCGATATTATCACCGGGTTCACCTCCTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGATAACAGAGGCTCA-CAACCCCTTATTTACCGAGAAAGCT-CGTAAGAGCTGCTAACTCATACCCCCGTGCTTGACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACTATGTACGCTACCATAACCACCTTAGCCCTAACTTCCTTAATTCCCCCTATCCTTACCACCTTCATCAATCCTAACAAAAAAAGCTCATACCCCCATTACGTAAAATCTATCGTCGCATCCACCTTTATCATCAGCCTCTTCCCCACAACAATATTTCTATGCCTAGACCAAGAAGCTATTATCTCAAGCTGACACTGAGCAACAACCCAAACAATTCAACTCTCCCTAAGCTT&lt;br /&gt;
Pongo     		AAGCTTCACCGGCGCAACCACCCTCATGATTGCCCATGGACTCACATCCTCCCTACTGTTCTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGCATCATAATCCTCTCTCAAGGCCTTCAAACTCTACTCCCCCTAATAGCCCTCTGATGACTTCTAGCAAGCCTCACTAACCTTGCCCTACCACCCACCATCAACCTTCTAGGAGAACTCTCCGTACTAATAGCCATATTCTCTTGATCTAACATCACCATCCTACTAACAGGACTCAACATACTAATCACAACCCTATACTCTCTCTATATATTCACCACAACACAACGAGGTACACCCACACACCACATCAACAACATAAAACCTTCTTTCACACGCGAAAATACCCTCATGCTCATACACCTATCCCCCATCCTCCTCTTATCCCTCAACCCCAGCATCATCGCTGGGTTCGCCTACTGTAAATATAGTTTAACCAAAACATTAGATTGTGAATCTAATAATAGGGCCCCA-CAACCCCTTATTTACCGAGAAAGCT-CACAAGAACTGCTAACTCTCACT-CCATGTGTGACAACATGGCTTTCTCAGCTTTTAAAGGATAACAGCTATCCCTTGGTCTTAGGATCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAACAGCCATGTTTACCACCATAACTGCCCTCACCTTAACTTCCCTAATCCCCCCCATTACCGCTACCCTCATTAACCCCAACAAAAAAAACCCATACCCCCACTATGTAAAAACGGCCATCGCATCCGCCTTTACTATCAGCCTTATCCCAACAACAATATTTATCTGCCTAGGACAAGAAACCATCGTCACAAACTGATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT&lt;br /&gt;
Hylobates 		AAGCTTTACAGGTGCAACCGTCCTCATAATCGCCCACGGACTAACCTCTTCCCTGCTATTCTGCCTTGCAAACTCAAACTACGAACGAACTCACAGCCGCATCATAATCCTATCTCGAGGGCTCCAAGCCTTACTCCCACTGATAGCCTTCTGATGACTCGCAGCAAGCCTCGCTAACCTCGCCCTACCCCCCACTATTAACCTCCTAGGTGAACTCTTCGTACTAATGGCCTCCTTCTCCTGGGCAAACACTACTATTACACTCACCGGGCTCAACGTACTAATCACGGCCCTATACTCCCTTTACATATTTATCATAACACAACGAGGCACACTTACACACCACATTAAAAACATAAAACCCTCACTCACACGAGAAAACATATTAATACTTATGCACCTCTTCCCCCTCCTCCTCCTAACCCTCAACCCTAACATCATTACTGGCTTTACTCCCTGTAAACATAGTTTAATCAAAACATTAGATTGTGAATCTAACAATAGAGGCTCG-AAACCTCTTGCTTACCGAGAAAGCC-CACAAGAACTGCTAACTCACTATCCCATGTATGACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAGCAATGTACACCACCATAGCCATTCTAACGCTAACCTCCCTAATTCCCCCCATTACAGCCACCCTTATTAACCCCAATAAAAAGAACTTATACCCGCACTACGTAAAAATGACCATTGCCTCTACCTTTATAATCAGCCTATTTCCCACAATAATATTCATGTGCACAGACCAAGAAACCATTATTTCAAACTGACACTGAACTGCAACCCAAACGCTAGAACTCTCCCTAAGCTT&lt;br /&gt;
Macaca_fuscata		AAGCTTTTCCGGCGCAACCATCCTTATGATCGCTCACGGACTCACCTCTTCCATATATTTCTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGTACCATACTACTGTCCCGAGGACTTCAAATCCTACTTCCACTAACAGCCTTTTGATGATTAACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATCAATCTACTAGGTGAACTCTTTGTAATCGCAACCTCATTCTCCTGATCCCATATCACCATTATGCTAACAGGACTTAACATATTAATTACGGCCCTCTACTCTCTCCACATATTCACTACAACACAACGAGGAACACTCACACATCACATAATCAACATAAAGCCCCCCTTCACACGAGAAAACACATTAATATTCATACACCTCGCTCCAATTATCCTTCTATCCCTCAACCCCAACATCATCCTGGGGTTTACCTCCTGTAGATATAGTTTAACTAAAACACTAGATTGTGAATCTAACCATAGAGACTCA-CCACCTCTTATTTACCGAGAAAACT-CGCAAGGACTGCTAACCCATGTACCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAAATAAAAGTAATAATCATGCACACCCCCATCATTATAACAACCCTTATCTCCCTAACTCTCCCAATTTTTGCCACCCTCATCAACCCTTACAAAAAACGTCCATACCCAGATTACGTAAAAACAACCGTAATATATGCTTTCATCATCAGCCTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAACAACCATTTGGAGCTGACATTGAATAATGACCCAAACACTAGACCTAACGCTAAGCTT&lt;br /&gt;
M_mulatta		AAGCTTTTCTGGCGCAACCATCCTCATGATTGCTCACGGACTCACCTCTTCCATATATTTCTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGTACCATACTACTGTCCCGGGGACTTCAAATCCTACTTCCACTAACAGCTTTCTGATGATTAACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATCAACCTACTAGGTGAACTCTTTGTAATCGCGACCTCATTCTCCTGGTCCCATATCACCATTATATTAACAGGATTTAACATACTAATTACGGCCCTCTACTCCCTCCACATATTCACCACAACACAACGAGGAGCACTCACACATCACATAATCAACATAAAACCCCCCTTCACACGAGAAAACATATTAATATTCATACACCTCGCTCCAATCATCCTCCTATCTCTCAACCCCAACATCATCCTGGGGTTTACTTCCTGTAGATATAGTTTAACTAAAACATTAGATTGTGAATCTAACCATAGAGACTTA-CCACCTCTTATTTACCGAGAAAACT-CGCGAGGACTGCTAACCCATGTATCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGACCTTAGGAGTCAAAAATATTGGTGCAACTCCAAATAAAAGTAATAATCATGCACACCCCTATCATAATAACAACCCTTATCTCCCTAACTCTCCCAATTTTTGCCACCCTCATCAACCCTTACAAAAAACGTCCATACCCAGATTACGTAAAAACAACCGTAATATATGCTTTCATCATCAGCCTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAACAACCATTTGAAGCTGACATTGAATAATAACCCAAACACTAGACCTAACACTAAGCTT&lt;br /&gt;
M_fascicularis		AAGCTTCTCCGGCGCAACCACCCTTATAATCGCCCACGGGCTCACCTCTTCCATGTATTTCTGCTTGGCCAATTCAAACTATGAGCGCACTCATAACCGTACCATACTACTATCCCGAGGACTTCAAATTCTACTTCCATTGACAGCCTTCTGATGACTCACAGCAAGCCTTACTAACCTTGCCCTACCCCCCACTATTAATCTACTAGGCGAACTCTTTGTAATCACAACTTCATTTTCCTGATCCCATATCACCATTGTGTTAACGGGCCTTAATATACTAATCACAGCCCTCTACTCTCTCCACATGTTCATTACAGTACAACGAGGAACACTCACACACCACATAATCAATATAAAACCCCCCTTCACACGAGAAAACATATTAATATTCATACACCTCGCTCCAATTATCCTTCTATCTCTCAACCCCAACATCATCCTGGGGTTTACCTCCTGTAAATATAGTTTAACTAAAACATTAGATTGTGAATCTAACTATAGAGGCCTA-CCACTTCTTATTTACCGAGAAAACT-CGCAAGGACTGCTAATCCATGCCTCCGTACTTAAAACTACGGTTTCCTCAACTTTTAAAGGATAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAAATAAAAGTAATAATCATGCACACCCCCATCATAATAACAACCCTCATCTCCCTGACCCTTCCAATTTTTGCCACCCTCACCAACCCCTATAAAAAACGTTCATACCCAGACTACGTAAAAACAACCGTAATATATGCTTTTATTACCAGTCTCCCCTCAACAACCCTATTCATCCTCTCAAACCAAGAAACAACCATTTGGAGTTGACATTGAATAACAACCCAAACATTAGACCTAACACTAAGCTT&lt;br /&gt;
M_sylvanus		AAGCTTCTCCGGTGCAACTATCCTTATAGTTGCCCATGGACTCACCTCTTCCATATACTTCTGCTTGGCCAACTCAAACTACGAACGCACCCACAGCCGCATCATACTACTATCCCGAGGACTCCAAATCCTACTCCCACTAACAGCCTTCTGATGATTCACAGCAAGCCTTACTAATCTTGCTCTACCCTCCACTATTAATCTACTGGGCGAACTCTTCGTAATCGCAACCTCATTTTCCTGATCCCACATCACCATCATACTAACAGGACTGAACATACTAATTACAGCCCTCTACTCTCTTCACATATTCACCACAACACAACGAGGAGCGCTCACACACCACATAATTAACATAAAACCACCTTTCACACGAGAAAACATATTAATACTCATACACCTCGCTCCAATTATTCTTCTATCTCTTAACCCCAACATCATTCTAGGATTTACTTCCTGTAAATATAGTTTAATTAAAACATTAGACTGTGAATCTAACTATAGAAGCTTA-CCACTTCTTATTTACCGAGAAAACT-TGCAAGGACCGCTAATCCACACCTCCGTACTTAAAACTACGGTTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGCCTTAGGAGTCAAAAATATTGGTGCAACTCCAAATAAAAGTAATAATCATGTATACCCCCATCATAATAACAACTCTCATCTCCCTAACTCTTCCAATTTTCGCTACCCTTATCAACCCCAACAAAAAACACCTATATCCAAACTACGTAAAAACAGCCGTAATATATGCTTTCATTACCAGCCTCTCTTCAACAACTTTATATATATTCTTAAACCAAGAAACAATCATCTGAAGCTGGCACTGAATAATAACCCAAACACTAAGCCTAACATTAAGCTT&lt;br /&gt;
Saimiri_sciureus	AAGCTTCACCGGCGCAATGATCCTAATAATCGCTCACGGGTTTACTTCGTCTATGCTATTCTGCCTAGCAAACTCAAATTACGAACGAATTCACAGCCGAACAATAACATTTACTCGAGGGCTCCAAACACTATTCCCGCTTATAGGCCTCTGATGACTCCTAGCAAATCTCGCTAACCTCGCCCTACCCACAGCTATTAATCTAGTAGGAGAATTACTCACAATCGTATCTTCCTTCTCTTGATCCAACTTTACTATTATATTCACAGGACTTAATATACTAATTACAGCACTCTACTCACTTCATATGTATGCCTCTACACAGCGAGGTCCACTTACATACAGCACCAGCAATATAAAACCAATATTTACACGAGAAAATACGCTAATATTTATACATATAACACCAATCCTCCTCCTTACCTTGAGCCCCAAGGTAATTATAGGACCCTCACCTTGTAATTATAGTTTAGCTAAAACATTAGATTGTGAATCTAATAATAGAAGAATA-TAACTTCTTAATTACCGAGAAAGTG-CGCAAGAACTGCTAATTCATGCTCCCAAGACTAACAACTTGGCTTCCTCAACTTTTAAAGGATAGTAGTTATCCATTGGTCTTAGGAGCCAAAAACATTGGTGCAACTCCAAATAAAAGTAATA---ATACACTTCTCCATCACTCTAATAACACTAATTAGCCTACTAGCGCCAATCCTAGCTACCCTCATTAACCCTAACAAAAGCACACTATACCCGTACTACGTAAAACTAGCCATCATCTACGCCCTCATTACCAGTACCTTATCTATAATATTCTTTATCCTTACAGGCCAAGAATCAATAATTTCAAACTGACACTGAATAACTATCCAAACCATCAAACTATCCCTAAGCTT&lt;br /&gt;
;&lt;br /&gt;
end;&lt;br /&gt;
&lt;br /&gt;
begin mrbayes; &lt;br /&gt;
    set autoclose=yes nowarn=yes; &lt;br /&gt;
    lset nst=6 rates=gamma; &lt;br /&gt;
    mcmc nruns=1 ngen=10000 samplefreq=10; &lt;br /&gt;
end;&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
A PBS Pro batch script must be created to run your job.  The first script below shows a MPI parallel run&lt;br /&gt;
of the above &amp;#039;.nex&amp;#039; input file.  This script selects 4 processors (cores) and allows PBS to put them on any&lt;br /&gt;
compute node.  Note, that when running any parallel program one must be cognizant of the scaling &lt;br /&gt;
properties of its parallel algorithm; in other words, how much does a given job&amp;#039;s running time drop&lt;br /&gt;
as one doubles the number of processors used.  All parallel programs arrive at point of diminishing returns&lt;br /&gt;
that depend on the algorithm, size of the problem being solved, and the performance features of the &lt;br /&gt;
system that it is being run on.  We might have chosen to run this job on 8, 16, or 32 processors (cores),&lt;br /&gt;
but would only do so if the improvement in performance scales.  Improvements of less than 25% after a&lt;br /&gt;
doubling are an indication of a reasonable maximum number of processors under those particular set&lt;br /&gt;
of circumstances&lt;br /&gt;
&lt;br /&gt;
Here is the 4 processor MPI parallel SLURM batch script:&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
#!/bin/bash&lt;br /&gt;
#SBATCH --partition production&lt;br /&gt;
#SBATCH --job-name MRBAYES_mpi&lt;br /&gt;
#SBATCH --nodes=4&lt;br /&gt;
#SBATCH --ntasks=1&lt;br /&gt;
#SBATCH --mem=1920&lt;br /&gt;
&lt;br /&gt;
# Find out name of master execution host (compute node)&lt;br /&gt;
echo -n &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; SBATCH Master compute node is: &amp;quot;&lt;br /&gt;
hostname&lt;br /&gt;
&lt;br /&gt;
# You must explicitly change to the working directory in SLURM&lt;br /&gt;
cd $SLURM_SUBMIT_DIR&lt;br /&gt;
&lt;br /&gt;
# Use &amp;#039;mpirun&amp;#039; and point to the MPI parallel executable to run&lt;br /&gt;
echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; Begin MRBAYES MPI Run ...&amp;quot;&lt;br /&gt;
echo &amp;quot;&amp;quot;&lt;br /&gt;
mpirun -np 4 /share/apps/mrbayes/default/bin/mb ./primates.nex &amp;gt; primates.out 2&amp;gt;&amp;amp;1&lt;br /&gt;
echo &amp;quot;&amp;quot;&lt;br /&gt;
echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; End   MRBAYES MPI Run ...&amp;quot;&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This script can be dropped into a file (say &amp;#039;mrbayes_mpi.job) on ANDY and&lt;br /&gt;
run with:&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
qsub mrbayes_mpi.job&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
This test case should take no more than a couple of minutes to run and will produce SLURM output and&lt;br /&gt;
error files beginning with the job name &amp;#039;MRBAYES_mpi&amp;#039;.  Other MrBayes specific outputs will also be&lt;br /&gt;
produced.  Details on the meaning of the PBS script are covered above in this Wiki&amp;#039;s SLURM section.  The&lt;br /&gt;
most important lines are &amp;#039;#SBATCH --nodes=4 ntasks=1 mem=1920&amp;#039;.  The &lt;br /&gt;
first instructs SLURM to select 4 resource &amp;#039;chunks&amp;#039; each with 1 processor (core) and 1,920 MBs of memory&lt;br /&gt;
in it for the job (on ANDY as much as 2,880 MBs might have been selected, on PENZIAS this number is 3860mb).  &lt;br /&gt;
The second line instructs SLURM to place this job wherever the least used resources are found (i.e. freely).  &lt;br /&gt;
The master compute node that it finally selects to run your job will be printed in the SLURM output file by the &amp;#039;hostname&amp;#039; command. &lt;br /&gt;
As this is a parallel job, other compute nodes may also be called into service to complete this job.&lt;br /&gt;
&lt;br /&gt;
The CUNY HPC Center also provides a serial version of MrBayes.  A SLURM batch script for running the &lt;br /&gt;
serial version is easy to prepare from the above by making a few changes.  Here is a listing of the&lt;br /&gt;
differences between the above MPI script and the serial script:&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
3,4c3,4&lt;br /&gt;
&amp;lt; #SBATCH --job-name MRBAYES_mpi&lt;br /&gt;
&amp;lt; #SBATCH --nodes=4&lt;br /&gt;
  #SBATCH --ntasks=1&lt;br /&gt;
  #SBATCH --mem=2880&lt;br /&gt;
---&lt;br /&gt;
&amp;gt; #SBATCH --job-name MRBAYES_serial&lt;br /&gt;
&amp;gt; #SBATCH --nodes=1&lt;br /&gt;
  #SBATCH --ntasks=1&lt;br /&gt;
16c16&lt;br /&gt;
&amp;lt; echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; Begin MRBAYES MPI Run ...&amp;quot;&lt;br /&gt;
---&lt;br /&gt;
&amp;gt; echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; Begin MRBAYES Serial Run ...&amp;quot;&lt;br /&gt;
18c18&lt;br /&gt;
&amp;lt; mpirun -np 4 /share/apps/mrbayes/default/bin/mb ./primates.nex&lt;br /&gt;
---&lt;br /&gt;
&amp;gt; /share/apps/mrbayes/default/bin/mb-serial ./primates.nex&lt;br /&gt;
20c20&lt;br /&gt;
&amp;lt; echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; End   MRBAYES MPI Run ...&amp;quot;&lt;br /&gt;
---&lt;br /&gt;
&amp;gt; echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; End   MRBAYES Serial Run ...&amp;quot;&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Finally, it is possible to run MrBayes in GPU-accelerated mode on PENZIAS (only).  This is an experimental&lt;br /&gt;
version of the code and users are cautioned to check their results and note their performance to &lt;br /&gt;
be sure they are getting accurate answers in shorter time periods.   Nothing is worse in HPC than&lt;br /&gt;
going in the wrong direction, more slowly (this principle applies to NYC Taxi rides as well).  Here&lt;br /&gt;
is yet another script that will run the GPU-accelerated version of MrBayes (again, on PENZIAS only).&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
#!/bin/bash&lt;br /&gt;
#SBATCH --partition production&lt;br /&gt;
#SBATCH --job-name MRBAYES_gpu&lt;br /&gt;
#SBATCH --nodes=1&lt;br /&gt;
#SBATCH --ntasks=1&lt;br /&gt;
#SBATCH --gres=gpu:1 &lt;br /&gt;
#SBATCH --accel=kepler&lt;br /&gt;
&lt;br /&gt;
# Find out name of master execution host (compute node)&lt;br /&gt;
echo -n &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; SLURM Master compute node is: &amp;quot;&lt;br /&gt;
hostname&lt;br /&gt;
&lt;br /&gt;
# You must explicitly change to the working directory in SLURM&lt;br /&gt;
cd $SLURM_SUBMIT_DIR&lt;br /&gt;
&lt;br /&gt;
# Point to the GPU parallel executable to run&lt;br /&gt;
echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; Begin MRBAYES GPU Run ...&amp;quot;&lt;br /&gt;
echo &amp;quot;&amp;quot;&lt;br /&gt;
/share/apps/mrbayes/default/bin/mb-gpu ./primates.nex&lt;br /&gt;
echo &amp;quot;&amp;quot;&lt;br /&gt;
echo &amp;quot;&amp;gt;&amp;gt;&amp;gt;&amp;gt; End   MRBAYES GPU Run ...&amp;quot;&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
There are several differences worth pointing out.  First,  he resource request line &amp;#039;-l select&amp;#039; request more that just&lt;br /&gt;
a processor and some memory, but also a GPU (ntasks=1) and a particular flavor of GPU (accel=kepler).&lt;br /&gt;
Second the the name of the executable, is now &amp;#039;mb-gpu&amp;#039;, which selects the GPU-accelerated&lt;br /&gt;
version of the code.&lt;/div&gt;</summary>
		<author><name>James</name></author>
	</entry>
</feed>