BEST

From CUNYHPC
Jump to: navigation, search

Currently, BEST is available on ANDY at the CUNY HPC Center.

To run BEST, first a NEXUS-formatted, DNA sequence comparison input file (e.g. a '.nex' file) must be created using MrBayes. See the section on MrBayes below for this. Here is an example NEXUS input file:

#NEXUS

begin data;
   dimensions ntax=17 nchar=432;
   format datatype=dna missing=?;
   matrix
   human       ctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggacaacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcaggctgcctatcagaaagtggtggctggtgtggctaatgccctggcccacaagtatcac
   tarsier     ctgactgctgaagagaaggccgccgtcactgccctgtggggcaaggtagacgtggaagatgttggtggtgaggccctgggcaggctgctggtcgtctacccatggacccagaggttctttgactcctttggggacctgtccactcctgccgctgttatgagcaatgctaaggtcaaggcccatggcaaaaaggtgctgaacgcctttagtgacggcatggctcatctggacaacctcaagggcacctttgctaagctgagtgagctgcactgtgacaaattgcacgtggatcctgagaatttcaggctcttgggcaatgtgctggtgtgtgtgctggcccaccactttggcaaagaattcaccccgcaggttcaggctgcctatcagaaggtggtggctggtgtggctactgccttggctcacaagtaccac
   bushbaby    ctgactcctgatgagaagaatgccgtttgtgccctgtggggcaaggtgaatgtggaagaagttggtggtgaggccctgggcaggctgctggttgtctacccatggacccagaggttctttgactcctttggggacctgtcctctccttctgctgttatgggcaaccctaaagtgaaggcccacggcaagaaggtgctgagtgcctttagcgagggcctgaatcacctggacaacctcaagggcacctttgctaagctgagtgagctgcattgtgacaagctgcacgtggaccctgagaacttcaggctcctgggcaacgtgctggtggttgtcctggctcaccactttggcaaggatttcaccccacaggtgcaggctgcctatcagaaggtggtggctggtgtggctactgccctggctcacaaataccac
   hare        ctgtccggtgaggagaagtctgcggtcactgccctgtggggcaaggtgaatgtggaagaagttggtggtgagaccctgggcaggctgctggttgtctacccatggacccagaggttcttcgagtcctttggggacctgtccactgcttctgctgttatgggcaaccctaaggtgaaggctcatggcaagaaggtgctggctgccttcagtgagggtctgagtcacctggacaacctcaaaggcaccttcgctaagctgagtgaactgcattgtgacaagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggttattgtgctgtctcatcactttggcaaagaattcactcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccac
   rabbit      ctgtccagtgaggagaagtctgcggtcactgccctgtggggcaaggtgaatgtggaagaagttggtggtgaggccctgggcaggctgctggttgtctacccatggacccagaggttcttcgagtcctttggggacctgtcctctgcaaatgctgttatgaacaatcctaaggtgaaggctcatggcaagaaggtgctggctgccttcagtgagggtctgagtcacctggacaacctcaaaggcacctttgctaagctgagtgaactgcactgtgacaagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattcactcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccac
   cow         ctgactgctgaggagaaggctgccgtcaccgccttttggggcaaggtgaaagtggatgaagttggtggtgaggccctgggcaggctgctggttgtctacccctggactcagaggttctttgagtcctttggggacttgtccactgctgatgctgttatgaacaaccctaaggtgaaggcccatggcaagaaggtgctagattcctttagtaatggcatgaagcatctcgatgacctcaagggcacctttgctgcgctgagtgagctgcactgtgataagctgcatgtggatcctgagaacttcaagctcctgggcaacgtgctagtggttgtgctggctcgcaattttggcaaggaattcaccccggtgctgcaggctgactttcagaaggtggtggctggtgtggccaatgccctggcccacagatatcat
   sheep       ctgactgctgaggagaaggctgccgtcaccggcttctggggcaaggtgaaagtggatgaagttggtgctgaggccctgggcaggctgctggttgtctacccctggactcagaggttctttgagcactttggggacttgtccaatgctgatgctgttatgaacaaccctaaggtgaaggcccatggcaagaaggtgctagactcctttagtaacggcatgaagcatctcgatgacctcaagggcacctttgctcagctgagtgagctgcactgtgataagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtggttgtgctggctcgccaccatggcaatgaattcaccccggtgctgcaggctgactttcagaaggtggtggctggtgttgccaatgccctggcccacaaatatcac
   pig         ctgtctgctgaggagaaggaggccgtcctcggcctgtggggcaaagtgaatgtggacgaagttggtggtgaggccctgggcaggctgctggttgtctacccctggactcagaggttcttcgagtcctttggggacctgtccaatgccgatgccgtcatgggcaatcccaaggtgaaggcccacggcaagaaggtgctccagtccttcagtgacggcctgaaacatctcgacaacctcaagggcacctttgctaagctgagcgagctgcactgtgaccagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgatagtggttgttctggctcgccgccttggccatgacttcaacccgaatgtgcaggctgcttttcagaaggtggtggctggtgttgctaatgccctggcccacaagtaccac
   elephseal   ttgacggcggaggagaagtctgccgtcacctccctgtggggcaaagtgaaggtggatgaagttggtggtgaagccctgggcaggctgctggttgtctacccctggactcagaggttctttgactcctttggggacctgtcctctcctaatgctattatgagcaaccccaaggtcaaggcccatggcaagaaggtgctgaattcctttagtgatggcctgaagaatctggacaacctcaagggcacctttgctaagctcagtgagctgcactgtgaccagctgcatgtggatcccgagaacttcaagctcctgggcaatgtgctggtgtgtgtgctggcccgccactttggcaaggaattcaccccacagatgcagggtgcctttcagaaggtggtagctggtgtggccaatgccctcgcccacaaatatcac
   rat         ctaactgatgctgagaaggctgctgttaatgccctgtggggaaaggtgaaccctgatgatgttggtggcgaggccctgggcaggctgctggttgtctacccttggacccagaggtactttgatagctttggggacctgtcctctgcctctgctatcatgggtaaccctaaggtgaaggcccatggcaagaaggtgataaacgccttcaatgatggcctgaaacacttggacaacctcaagggcacctttgctcatctgagtgaactccactgtgacaagctgcatgtggatcctgagaacttcaggctcctgggcaatatgattgtgattgtgttgggccaccacctgggcaaggaattcaccccctgtgcacaggctgccttccagaaggtggtggctggagtggccagtgccctggctcacaagtaccac
   mouse       ctgactgatgctgagaagtctgctgtctcttgcctgtgggcaaaggtgaaccccgatgaagttggtggtgaggccctgggcaggctgctggttgtctacccttggacccagcggtactttgatagctttggagacctatcctctgcctctgctatcatgggtaatcccaaggtgaaggcccatggcaaaaaggtgataactgcctttaacgagggcctgaaaaacctggacaacctcaagggcacctttgccagcctcagtgagctccactgtgacaagctgcatgtggatcctgagaacttcaggctcctaggcaatgcgatcgtgattgtgctgggccaccacctgggcaaggatttcacccctgctgcacaggctgccttccagaaggtggtggctggagtggccactgccctggctcacaagtaccac
   hamster     ctgactgatgctgagaaggcccttgtcactggcctgtggggaaaggtgaacgccgatgcagttggcgctgaggccctgggcaggttgctggttgtctacccttggacccagaggttctttgaacactttggagacctgtctctgccagttgctgtcatgaataacccccaggtgaaggcccatggcaagaaggtgatccactccttcgctgatggcctgaaacacctggacaacctgaagggcgccttttccagcctgagtgagctccactgtgacaagctgcacgtggatcctgagaacttcaagctcctgggcaatatgatcatcattgtgctgatccacgacctgggcaaggacttcactcccagtgcacagtctgcctttcataaggtggtggctggtgtggccaatgccctggctcacaagtaccac
   marsupial   ttgacttctgaggagaagaactgcatcactaccatctggtctaaggtgcaggttgaccagactggtggtgaggcccttggcaggatgctcgttgtctacccctggaccaccaggttttttgggagctttggtgatctgtcctctcctggcgctgtcatgtcaaattctaaggttcaagcccatggtgctaaggtgttgacctccttcggtgaagcagtcaagcatttggacaacctgaagggtacttatgccaagttgagtgagctccactgtgacaagctgcatgtggaccctgagaacttcaagatgctggggaatatcattgtgatctgcctggctgagcactttggcaaggattttactcctgaatgtcaggttgcttggcagaagctcgtggctggagttgcccatgccctggcccacaagtaccac
   duck        tggacagccgaggagaagcagctcatcaccggcctctggggcaaggtcaatgtggccgactgtggagctgaggccctggccaggctgctgatcgtctacccctggacccagaggttcttcgcctccttcgggaacctgtccagccccactgccatccttggcaaccccatggtccgtgcccatggcaagaaagtgctcacctccttcggagatgctgtgaagaacctggacaacatcaagaacaccttcgcccagctgtccgagctgcactgcgacaagctgcacgtggaccctgagaacttcaggctcctgggtgacatcctcatcatcgtcctggccgcccacttcaccaaggatttcactcctgactgccaggccgcctggcagaagctggtccgcgtggtggcccacgctctggcccgcaagtaccac
   chicken     tggactgctgaggagaagcagctcatcaccggcctctggggcaaggtcaatgtggccgaatgtggggccgaagccctggccaggctgctgatcgtctacccctggacccagaggttctttgcgtcctttgggaacctctccagccccactgccatccttggcaaccccatggtccgcgcccacggcaagaaagtgctcacctcctttggggatgctgtgaagaacctggacaacatcaagaacaccttctcccaactgtccgaactgcattgtgacaagctgcatgtggaccccgagaacttcaggctcctgggtgacatcctcatcattgtcctggccgcccacttcagcaaggacttcactcctgaatgccaggctgcctggcagaagctggtccgcgtggtggcccatgccctggctcgcaagtaccac
   xenlaev     tggacagctgaagagaaggccgccatcacttctgtatggcagaaggtcaatgtagaacatgatggccatgatgccctgggcaggctgctgattgtgtacccctggacccagagatacttcagtaactttggaaacctctccaattcagctgctgttgctggaaatgccaaggttcaagcccatggcaagaaggttctttcagctgttggcaatgccattagccatattgacagtgtgaagtcctctctccaacaactcagtaagatccatgccactgaactgtttgtggaccctgagaactttaagcgttttggtggagttctggtcattgtcttgggtgccaaactgggaactgccttcactcctaaagttcaggctgcttgggagaaattcattgcagttttggttgatggtcttagccagggctataac
   xentrop     tggacagctgaagaaaaagcaaccattgcttctgtgtgggggaaagtcgacattgaacaggatggccatgatgcattatccaggctgctggttgtttatccctggactcagaggtacttcagcagttttggaaacctctccaatgtctccgctgtctctggaaatgtcaaggttaaagcccatggaaataaagtcctgtcagctgttggcagtgcaatccagcatctggatgatgtgaagagccaccttaaaggtcttagcaagagccatgctgaggatcttcatgtggatcccgaaaacttcaagcgccttgcggatgttctggtgatcgttctggctgccaaacttggatctgccttcactccccaagtccaagctgtctgggagaagctcaatgcaactctggtggctgctcttagccatggctacttc
   ;
end;

begin mrbayes;
   charset non_coding = 1-90 358-432;
   charset coding     = 91-357;
   partition region = 2:non_coding,coding;
   set partition = region;
   lset applyto=(2) nucmodel=codon;
   prset ratepr=variable;
   mcmc ngen=5000 nchains=1 samplefreq=10;
end;

Next, a SLURM batch script must be created to run your job. The first script below shows a MPI parallel script for the above '.nex' input file. Note that the number of processors that can be used by the job is limited to the number of chains in the input file. Here, we have just 2 chains and therefore can only request 2 processors. If you make the mistake of asking for more processors than input file chains, you will get the following error message:

      The number of chains must be at least as great
      as the number of processors (in this case 4)

Also, to include all required environmental variables and the path to the BEST executable run the modules load command (the modules utility is discussed in detail above):

module load best

Here is the MPI parallel SLURM batch script for BEST that request 2 processors, one for each chain in the input file:

#!/bin/bash
#SBATCH --partition production
#SBATCH --job-name BEST_parallel
#SBATCH --nodes=2
#SBATCH --ntasks=1
#SBATCH --mem=2880

# Find out name of master execution host (compute node)
echo -n ">>>> SLURM Master compute node is: "
hostname

# You must explicitly change to the working directory in SLURM
cd $SLURM_SUBMIT_DIR

# Use 'mpirun' and point to the MPI parallel executable to run
echo ">>>> Begin BEST Parallel Run ..."
mpirun -np mbbest ./bglobin.nex  > best_mpi.out 2>&1
echo ">>>> End   BEST Parallel Run ..."

This script can be dropped into a file (say 'best_mpi.job) on ANDY and run with:

qsub best_mpi.job

It should take less five minutes to run and will produce SLURM output and error files beginning with the job name 'BEST_parallel'. The primary BEAST application results will be written into the user-specified file at the end of the BEST command line after the greater-than sign. Here it is named 'best_mpi.out'. The expression '2>&1' combines Unix standard output from the program with Unix standard error. Users should always explicitly specify the name of the application's output file in this way to ensure that it is written directly into the user's working directory which has much more disk space than the SLURM spool directory on /var.

Details on the meaning of the PBS script are covered below in the SLURM section. The most important lines are the '#SBATCH --nodes ntasks=1 mem=2880'. The first instructs SLURM to select 2 resource 'chunks' each with 1 processor (core) and 2,880 MBs of memory in it for the job. The second instructs SLURM to place this job wherever the least used resources are found (freely). The master compute node that it finally selects to run your job will be printed in the SLURM output file by the 'hostname' command.

The CUNY HPC Center also provides a serial version of BEST. A SLURM batch script for running the serial version of BEST follows:

#!/bin/bash
#SBATCH --partition production
#SBATCH --job-name BEST_serial
#SBATCH --nodes=1
#SBATCH --ntasks=1
#SBATCH --mem=2880

# Find out name of master execution host (compute node)
echo -n ">>>> PBS Master compute node is: "
hostname

# You must explicitly change to the working directory in SLURM
cd $SLURM_SUBMIT_DIR

# Just point to the serial executable to run
echo ">>>> Begin BEST Serial Run ..."
mbbest_serial ./bglobin.nex > best_ser.out 2>&1
echo ">>>> End   BEST Serial Run ..."