RAXML: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

27 October 2022

20 October 2022

  • curprev 20:1720:17, 20 October 2022‎ James talk contribs‎ 5,783 bytes +5,783‎ Created page with "Examples of running both parallel and serial jobs are presented below. More information can be found here [http://www.exelixis-lab.org] To run RAxML first a PHYLIP file of aligned DNA or amino-acid sequences similar to the one shown here must be created. This file, 'alg.phy', is in interleaved format: <pre> 5 60 Tax1 CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAG Tax2 CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGG Tax3 CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGG Tax4..."
Retrieved from "http://163.238.128.48/cunyhpc/index.php/RAXML"