All public logs
Jump to navigation
Jump to search
Combined display of all available logs of HPCC Wiki. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)- 19:32, 27 October 2022 James talk contribs uploaded File:CUNY-HPCC-HEADER-LOGO.jpg
- 19:32, 27 October 2022 James talk contribs created page File:CUNY-HPCC-HEADER-LOGO.jpg
- 20:38, 20 October 2022 James talk contribs moved page CoArray Fortran and Unified Parallel C (PGAS) Program Compilation and PBS Job Submission to CoArray Fortran and Unified Parallel C (PGAS) Program Compilation and SLURM Job Submission (Text replacement - "[pP][bB][sS]" to "SLURM")
- 20:27, 20 October 2022 James talk contribs deleted page FDPPDIV (content was: "'''Availability:''' PENZIAS '''Module file:''' fdppdiv '''Citation''': Heath, Huelsenbeck, Stadler. 2013. The fossilized birth-death process: A coherent model of fossil calibration for divergence time estimation. arXiv preprint arXiv:1310.2968. Heath, Holder, Huelsenbeck. 2012. A Dirichlet process prior for estimating lineage-specific substitution rates. Molecular Biology and Evo...", and the only contributor was "James" (talk))
- 20:26, 20 October 2022 James talk contribs deleted page SAS (content was: "In addition, SAS has many business solutions that enable large scale software solutions for areas such as IT management, human resource management, financial management, business intelligence, customer relationship management and more. SAS software is currently installed at the Neptune server. In order to run it users need to :* Login to "Karle" server. The procedure is described...", and the only contributor was "James" (talk))
- 20:25, 20 October 2022 James talk contribs deleted page HONDO PLUS (content was: "The Hondo Plus installed at the CUNY HPC Center is the serial version of the application and it is currently available only on ANDY. It was compiled with the Intel Fortran compiler. The installation directory (/share/apps/hondoplus/default) includes a large number of examples in the form of a test suite of input decks and correct outputs in the directory; <pre> /share/apps/hondop...", and the only contributor was "James" (talk))
- 20:23, 20 October 2022 James talk contribs created page WRF (Created page with "There are two distinct WRF development trees and versions, one for production forecasting and another for research and development. NCAR's experimental, advanced research version, called ARW (Advanced Research WRF) features very high resolution and is being used to explore ways of improving the accuracy of hurricane tracking, hurricane intensity, and rainfall forecasts, among a host of other meteorological questions. It is ARW along with its pre- and post- processing mo...")
- 20:23, 20 October 2022 James talk contribs created page USEARCH (Created page with "USEARCH (64 bit version) is installed on Penzias HPC cluster. To start using USEARCH load corresponding module first: <pre> module load usearch </pre> Example SLURM script that can be used to submit a job with a typical USEARCH workflow is shown below: <pre> #!/bin/bash #SBATCH --partition production #SBATCH --job-name usearch_x #SBATCH --nodes=1 #SBATCH --ntasks=1 cd $SLURM_SUBMIT_DIR echo "Starting..." cp /share/apps/usearch/8.0.1623/sample/reads.fq ./ usearch8...")
- 20:22, 20 October 2022 James talk contribs created page TOPHAT (Created page with "The other tools in this collection, BOWTIE, CUFFLINKS, and SAMTOOLS are also installed at the CUNY HPC Center. Additional information can be found at the TOPHAT home page here [http://tophat.cbcb.umd.edu/index.html]. At the CUNY HPC Center TOPHAT is installed on ANDY. TOPHAT is a parallel threaded code (pthreads) that takes its input from a simple text file provided on the command line. Below is an example SLURM script that will run the mRNA test case provided with t...")
- 20:21, 20 October 2022 James talk contribs created page STRUCTURE (Created page with "The following SLURM batch script shows how to run a single, basic Structure serial job: <pre> #!/bin/bash #SBATCH --partition production #SBATCH --job-name STRUCT_simple #SBATCH --nodes=1 #SBATCH --ntasks=1 # Find out name of master execution host (compute node) echo -n ">>>> SLURM Master compute node is: " hostname # You must explicitly change to the working directory in SLURM cd $SLURM_SUBMIT_DIR # Set the root directory for the 'structure' binary STROOT=/share/ap...")
- 20:19, 20 October 2022 James talk contribs created page SAMTOOLS (Created page with "SAMTOOLS is part of a sequence alignment and analysis tool chain developed at John Hopkins, University of California at Berkeley, and Harvard, and distributed through the Center for Bioinformatics and Computational Biology. The other tools in this collection, BOWTIE, CUFFLINKS, and TOPHAT are also installed at the CUNY HPC Center. Additional information can be found at the SAMTOOLS home page here [http://samtools.sourceforge.net/index.shtml]. At the CUNY HPC Center S...")
- 20:18, 20 October 2022 James talk contribs created page SAGE (Created page with "Sage is built out of nearly 100 open-source packages and features a unified interface that integrates their functionality into a common experience. It is well-suited for education and research. Details on SAGE, including tutorials on its use are available at [http://www.sagemath.org]. The CUNY HPC Center has installed SAGE on KARLE, a 24 processor gateway server system that supports a number of interactive and GUI oriented applications such as MATLAB, SAS, R, and Math...")
- 20:17, 20 October 2022 James talk contribs created page RAXML (Created page with "Examples of running both parallel and serial jobs are presented below. More information can be found here [http://www.exelixis-lab.org] To run RAxML first a PHYLIP file of aligned DNA or amino-acid sequences similar to the one shown here must be created. This file, 'alg.phy', is in interleaved format: <pre> 5 60 Tax1 CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAG Tax2 CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGG Tax3 CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGG Tax4...")
- 20:17, 20 October 2022 James talk contribs created page QIIME (Created page with "Qiime is installed in Python/anaconda environment. There are 2 builds of Python/Anaconda - the one with python interpreter 2.7.13 and one with python interpreter 3.6.0. The text below refers to python 2.7.13. In order to use qiime the users must load module for qiime and activate the environment. The following 2 lines will do the job: <pre> module load qiime/1.9.1_FULL_P2.7 source activate qiime1 </pre> The P2.7 above indicates that the used python interpreter is...")
- 20:16, 20 October 2022 James talk contribs created page PYTHON (Created page with "On Penzias Python is provided as a part of development package Anaconda/Miniconda. Anaconda distribution includes libraries (i.e. numpy) while miniconda is empty shell which can accommodate various packages. In general there are 2 supported versions of Python installed on Penzias system: *Python 2.7.13 which can be accessed by loading module python/2.7.13_anaconda *Python 3.6 which can be accessed by loading module python/3.6.0_anaconda The same versions of Python...")
- 20:16, 20 October 2022 James talk contribs created page PyRAD (Created page with "Start up tutorials of the program can be found on following links http://nbviewer.ipython.org/gist/dereneaton/1f661bfb205b644086cc/tutorial_RAD_3.0.ipynb and on: http://nbviewer.ipython.org/gist/dereneaton/af9548ea0e94bff99aa0/pyRAD_v.3.0.ipynb Every user has to prepare the parameter file (in below example params.txt), which will hold parameters of PyRAD run. The full description of content of this file is given into manual (see above). To run PyRAD job first load...")
- 20:15, 20 October 2022 James talk contribs created page PHOENICS (Created page with "As suggested, the entire PHOENICS 2011 package is installed on ANDY and users can run the X11 version of the PHOENICS Commander display tool from ANDY's head node if they have connected using 'ssh -X andy.csi.cuny.edu' where the '-X' option ensures that X11 images are passed back to the original client. Doing this from outside the College of Staten Island campus where the CUNY HPC Center is located may produce poor results because the X11 traffic will have to be forward...")
- 20:15, 20 October 2022 James talk contribs created page ORCA (Created page with "In particular implemented methods are: '''Semi-empirical:''' INDO/S, MNDO, AM1, PM3, NDDO/1; '''Hartee Fock theory''' (RHF, UHF, ROHF and CASSCF) all in direct, semidirect, or conventional mode, different RI approximations; '''DFT''' including a reasonably large number of exchange and correlation functionals including hybrid DFT and the most recent double hybrid functionals; High level single reference correlation models: CCSD(T), QCISD(T), CEPA, CPF (with and without R...")
- 20:14, 20 October 2022 James talk contribs created page OpenFOAM (Created page with " First step in using the program is to load module file which will set up the environment. To do so please run the command <pre> module load openfoam/2.3.0 </pre> The script will ask you to load the bashrc file. Run the command: <pre> source /share/apps/openfoam/2.3.0/OpenFOAM-2.3.0/etc/bashrc </pre> Make directory for the project and put all your project files there. Change to this directory. Create a SLURM script for the type of job you want to use: For sequen...")
- 20:13, 20 October 2022 James talk contribs created page OCTOPUS (Created page with "Selecting the right queue based on system activity will ensure that your job starts as soon as possible. Complete information about the octopus package can be found at its homepage, http://www.tddft.org/programs/octopus. The on-line user manual is available at http://www.tddft.org/programs/octopus/wiki/index.php/Manual. The MPI parallel version Octopus has been installed on PENZIAS and ANDY (the older release is also installed on ANDY) with all its associated librarie...")
- 20:13, 20 October 2022 James talk contribs created page NS2 (Created page with "Running NS2 is a four step process. Prepare a Tcl script for NS2 like the example ('''''ex.tcl''''') shown below. This example has 2 nodes with 1 link and uses UDP agent with the CBR traffic generator. <pre> set ns [new Simulator] set tr [open trace.out w] $ns trace-all $tr proc finish {} { global ns tr $ns flush-trace close $tr exit 0 } set n0 [$ns node] set n1 [$ns node] $ns duplex-link $n0 $n1 1Mb 10ms DropTail set udp0 [new Agent...")
- 20:11, 20 October 2022 James talk contribs created page NAMD (Created page with "The main server for Molecular Dynamics Calculations is PENZIAS which supports both GPU and non GPU versions of NAMD. However the MPI only (no GPU support) parallel versions of NAMD are also installed on SALK and ANDY. In order to use the code please always load the NAMD module first. The following line will load application environment for NAMD on PENZIAS. GPU is not requested in below SLURM script. <pre> module load namd </pre> A batch submit script for NAMD th...")
- 20:10, 20 October 2022 James talk contribs deleted page MSMS (content was: "The program is designed to be command line compatible to MS, however no prior knowledge of MS is assumed for this document. Applications of MSMS include power studies, analytical comparisons, approximated Bayesian computation among many others. Because most applications require the generation of a large number of independent replicates, the code is designed to be efficient and fas...", and the only contributor was "James" (talk))
- 20:10, 20 October 2022 James talk contribs created page MRBAYES (Created page with "MrBayes is installed on ANDY and PENZIAS (GPU enabled version). In order to set-up the environment required to run MrBayes corresponding module needs to be loaded first. This is done with <pre> module load mrbayes </pre> Running MrBayes is a two-step process that first requires the creation of the NEXUS-formatted MrBayes input file and then the SLURM Pro script to run it. MrBayes can be run in serial, MPI-parallel, or GPU-accelerated mode (on PENZIAS only). Here is...")
- 20:10, 20 October 2022 James talk contribs created page MATHEMATICA (Created page with "=====Modes of Operation in Mathematica===== Mathematica can be run locally on an office workstation, directly on a server or cluster from its head node, or across the network between an office-local client and a remote server (a cluster for instance). It can be run serially or in parallel; its licenses can be provided locally or via a network-resident license server; and it can be run in command-line or GUI mode. The details of installing and running Mathematica on a l...")
- 20:09, 20 October 2022 James talk contribs deleted page MET (content was: "===Usage=== MET is a collection of components. Each of them requires a special input deck and generates outputs upon successful run. '''1. PB2NC.''' This tool is used to create NetCDF files from input PrepBufr files containing point observations. *Input: One PrepBufr point observation file and one configuration file. *Output: One NetCDF file containing the observations that have...", and the only contributor was "James" (talk))
- 20:08, 20 October 2022 James talk contribs created page LSDYNA (Created page with " Both 32-bit and 64-bit executables in both serial and parallel versions are provided. The MPI parallel versions use OpenMPI as their MPI parallel library, the HPC Center's default version of MPI. The serial executable can also be run in OpenMP (not to be confused with OpenMPI) node- local SMP-parallel mode. The names of the executable files in the '/share/apps/lsdyna/default/bin' directory are: <pre> ls-dyna_32.exe ls-dyna_64.exe ls-dyna-mpp32.exe ls-dyna_mpp64.e...")
- 20:07, 20 October 2022 James talk contribs created page IMA2 (Created page with "IMa2 is a serial program that is currently installed on ANDY at the CUNY HPC Center. It requires an input file and potentially several additional data files to run. Here we provide a script that will run the test input program supplied by the authors, 'ima2_testinput.u'. Completing this run may also require the prior file ('ima2_priorfile_4pops.txt') and the nested models file ('ima2_all_nested_models_2_pops.txt'). All these files can be copied out of the IMa2 installa...")
- 20:07, 20 October 2022 James talk contribs created page GPAW (Created page with "Complete GPAW documentation can be found at https://wiki.fysik.dtu.dk/gpaw/documentation/manual.html GPAW is currently available on Penzias HPC system. Two examples of running GPAW computation on Penzias are provided below. '''1. Single-core job.''' -- Copy single-core example to your current directory with <pre> cp /share/apps/gpaw/default/test/gpaw_serial_example.py ./ </pre> -- Prepare the job script: <pre> #!/bin/bash #SBATCH --partition production #SBATCH --jo...")
- 20:06, 20 October 2022 James talk contribs created page GENOMEPOP2 (Created page with "The CUNY HPC Center has installed GenomePop2 (/share/apps/genomepop) on ANDY. GenomePop2 is a serial code that reads all of its input parameters from a file in the user's working directory called 'GP2Input.txt'. How to set up such a file is explained in the How-To section at the GenomePop2 web-site here [http://webs.uvigo.es/acraaj/GP2howto.htm]. The following SLURM batch script runs the third example given in the How-To which defines different SNPs ancestral alleles i...")
- 20:05, 20 October 2022 James talk contribs created page GAUSS (Created page with "A SLURM submit script for GAUSS that runs on 1 processor (core) follows: <pre> #!/bin/bash #SBATCH --partition production #SBATCH --job-name GAUSS_job #SBATCH --nodes=1 #SBATCH --ntasks=1 #SBATCH --mem=2880 # Find out name of master execution host (compute node) echo -n ">>>> SLURM Master compute node is: " hostname echo "" # You must explicitly change to the working directory in SLURM cd $SLURM_SUBMIT_DIR # # Point to the serial executable to run # echo ">>>> Begin...")
- 20:05, 20 October 2022 James talk contribs created page GARLI (Created page with "At the CUNY HPC Center, GARLI is installed on on ANDY. GARLI has both a serial and MPI parallel version that takes its input from a simple text configuration file ('garli.conf') and a '.nex' sequence file ('rana.nex' for instance). Like other applications on ANDY, GARLI path and environment variables are controlled using the modules utility. To include all required environmental variables and the path to the GARLI executable run the modules load command (the modules uti...")
- 20:04, 20 October 2022 James talk contribs created page FDPPDIV (Created page with "'''Availability:''' PENZIAS '''Module file:''' fdppdiv '''Citation''': Heath, Huelsenbeck, Stadler. 2013. The fossilized birth-death process: A coherent model of fossil calibration for divergence time estimation. arXiv preprint arXiv:1310.2968. Heath, Holder, Huelsenbeck. 2012. A Dirichlet process prior for estimating lineage-specific substitution rates. Molecular Biology and Evolution 29:939-955. Heath. 2012. A hierarchical Bayesian model for calibrating estimates o...")
- 20:01, 20 October 2022 James talk contribs created page DL POLY (Created page with "DL_POLY is installed on ANDY under the user applications directory <pre> /share/apps/dlpoly </pre> The default is currently version 2.20, but users can select the more current version by referencing the 3.10 directory explicitly in their scripts. To run DL_POLY the user needs to provide a set of several files. Those that are '''required''' include: 1) The CONTROL file, which indicates to DL_POLY what kind of simulation you want to run, how much data you want to ga...")
- 19:59, 20 October 2022 James talk contribs created page CUFFLINKS (Created page with "At the CUNY HPC Center CUFFLINKS is installed on ANDY. CUFFLINKS is a parallel threaded code (pthreads) that takes its input from a simple text file provided on the command line. Below is an example SLURM script that will run the messenger RNA test case provided at the website here [http://cufflinks.cbcb.umd.edu/tutorial.html]. To include all required environmental variables and the path to the CUFFLINKS executable run the modules load command (the modules utility is d...")
- 19:59, 20 October 2022 James talk contribs created page CP2K (Created page with "At the CUNY HPC Center CP2K is installed on ANDY. CP2K can be built as a serial, MPI-parallel, or MPI-OpenMP-parallel code. At this time, only the MPI-parallel version of the application has been built for production use at the HPC Center. Further information on CP2K is available at the website here [http://www.cp2k.org/]. Below is an example PBS script that will run the CP2K H2O-32 test case provided with the CP2K distribution. It can be copied from the local insta...")
- 19:56, 20 October 2022 James talk contribs created page CoArray Fortran and Unified Parallel C (PGAS) Program Compilation and PBS Job Submission (Created page with "== CoArray Fortran and Unified Parallel C (PGAS) Program Compilation and PBS Job Submission == As part of its plan to offer CUNY HPC Center users a unique variety of HPC parallel programming alternatives (beyond even those described above), the HPC Center support a two cabinet 2816 core Cray XE6m system called SALK. This system supports two newer and similar, language-integrated and highly scalable approaches to parallel programming, CoArray Fortran (CAF) and Unified Par...")
- 19:55, 20 October 2022 James talk contribs created page BROWNIE (Created page with "BROWNIE is installed on the Andy cluster under the directory "/share/apps/brownie/default/bin/". The directory "/share/apps/brownie/default/examples/" contains two example files. In order to run one of these examples on Andy follow the steps: 1) create a directory and "cd" there: <pre> mkdir ./brownie_test && cd ./brownie_test </pre> 2) Copy the example input deck to the current directory: <pre> cp /share/apps/brownie/default/example/ratetest_example.nex ./ </pre>...")
- 19:55, 20 October 2022 James talk contribs created page BOWTIE2 (Created page with "At the CUNY HPC Center BOWTIE2 is installed on ANDY and PENZIAS. BOWTIE2 is a parallel threaded code (pthreads) that takes its input from a simple text file provided on the command line. Below is an example SLURM script that will run the lambda virus test case provided with the BOWTIE2 distribution which can be copied from the local installation directory to your current location as follows: <pre> cp /share/apps/bowtie2/default/examples/reference/lambda_virus.fa . cp /s...")
- 19:54, 20 October 2022 James talk contribs created page BEST (Created page with "Currently, BEST is available on ANDY at the CUNY HPC Center. To run BEST, first a NEXUS-formatted, DNA sequence comparison input file (e.g. a '.nex' file) must be created using MrBayes. See the section on MrBayes below for this. Here is an example NEXUS input file: <pre> #NEXUS begin data; dimensions ntax=17 nchar=432; format datatype=dna missing=?; matrix human ctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg...")
- 19:50, 20 October 2022 James talk contribs created page TRINITY (Created page with "Briefly, the process works like so: Inchworm assembles the RNA-seq data into the unique sequences of transcripts, often generating full-length transcripts for a dominant isoform, but then reports just the unique portions of alternatively spliced transcripts. Chrysalis clusters the Inchworm contigs into clusters and constructs complete de Bruijn graphs for each cluster. Each cluster represents the full transcriptonal complexity for a given gene (or sets of genes that sh...")
- 19:02, 20 October 2022 James talk contribs created page THRUST (Created page with "Thrust provides a rich collection of data parallel primitives such as scan, sort, and reduce, which can be combined together to implement complex algorithms with concise, readable source code. By describing your computation in terms of these high-level abstractions you provide Thrust with the freedom to select the most efficient implementation automatically. As a result, Thrust can be utilized in rapid prototyping of CUDA applications, where programmer productivity matte...")
- 19:01, 20 October 2022 James talk contribs created page STRUCTURAMA (Created page with " Importantly, the program can estimate the number of populations under the Dirichlet process prior. Markov chain Monte Carlo (MCMC) is used to approximate the posterior probability that individuals are assigned to specific populations. Structurama also allows the individuals to be admixed. Structurama implements a number of methods for summarizing the results of a Bayesian MCMC analysis of population structure. Perhaps most interestingly, the program finds the mean parti...")
- 19:00, 20 October 2022 James talk contribs created page SAS (Created page with "In addition, SAS has many business solutions that enable large scale software solutions for areas such as IT management, human resource management, financial management, business intelligence, customer relationship management and more. SAS software is currently installed at the Neptune server. In order to run it users need to :* Login to "Karle" server. The procedure is described in the [http://wiki.csi.cuny.edu/cunyhpc/index.php/Loggingin "How to Login"] article. :*...")
- 19:00, 20 October 2022 James talk contribs created page R (Created page with "In order to use R on Penzias, Appel, Andy or Karle please load the corresponding module: <pre> module load r </pre> Complete R documentation may be found at http://www.r-project.org/ ====Running R on Karle ==== The following is the "Hello World" program written in R: <pre> # Hello World example a <- c("Hello, world!") print(a) </pre> To run R job on Karle server, save your R script into the file (for example "hello.R") and use the following command to launch it:...")
- 18:59, 20 October 2022 James talk contribs created page Q/A (Created page with "Q1.Dear All, I am trying to run my job but Penzias doesn't accept it. I need to try a 16 nodes memory. Let me know, please what is my mistake. Below you have my job scripts: #!/bin/bash #PBS -q production #PBS -N test_nwchem #PBS -l select=2:ncpus=16:mem=23040mb #PBS -l place=free #PBS -V cd $PBS_O_WORKDIR A1. There are 2 mistakes here. From PBS point of view there is no nodes with 16 cores per node. The PBS "thinks" that all nodes have 8 cores. Second the maximum ava...")
- 18:56, 20 October 2022 James talk contribs created page PHRAP-PHRED (Created page with "PHRAP is a program for shotgun sequence assembly, but it can also be used for small sequence assemblies. Its key features include its use of data quality information, both direct (from phred trace analysis) and indirect (from pairwise read comparisons), to delineate the likely accurate base calls in each read. This helps discriminate repeats. It permits the use of the full reads in assembly, and allows a highly accurate consensus sequence to be generated. A probability...")
- 18:56, 20 October 2022 James talk contribs created page ParGAP (Created page with "Since knowledge of MPI is not required for use of this software, we now refer to the package as simply ParGAP. For more information visit the author's ParGAP home page at: http://www.ccs.neu.edu/home/gene/pargap.html. The package is installed on '''penzias''' cluster. Users must load module '''pargap'''. <pre> module load pargap </pre> The example below named '''parlist.g''' is a parallelization of a list. <pre> #WARNING: Read this with Read(), _not_ ParRead()...")
- 18:55, 20 October 2022 James talk contribs created page NWChem (Created page with "NWChem has been developed by the Molecular Sciences Software group at the Department of Energy's EMSL. The software is available on PENZIAS and ANDY. On both servers the module for NWChem must be loaded "prior" to run a job with the command: <pre> module load nwchem </pre> The above command will load the "default" version of NWChem. ====Performance Considerations==== The NWChem is GPU enabled meaning it supports GPU so the package can be used both in CPU or in "h...")
- 18:55, 20 October 2022 James talk contribs created page MSMS (Created page with "The program is designed to be command line compatible to MS, however no prior knowledge of MS is assumed for this document. Applications of MSMS include power studies, analytical comparisons, approximated Bayesian computation among many others. Because most applications require the generation of a large number of independent replicates, the code is designed to be efficient and fast. For the neutral case, it is comparable to MS and even faster for large recombination ra...")