All public logs
Jump to navigation
Jump to search
Combined display of all available logs of HPCC Wiki. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 20:17, 20 October 2022 James talk contribs created page RAXML (Created page with "Examples of running both parallel and serial jobs are presented below. More information can be found here [http://www.exelixis-lab.org] To run RAxML first a PHYLIP file of aligned DNA or amino-acid sequences similar to the one shown here must be created. This file, 'alg.phy', is in interleaved format: <pre> 5 60 Tax1 CCATCTCACGGTCGGTACGATACACCTGCTTTTGGCAG Tax2 CCATCTCACGGTCAGTAAGATACACCTGCTTTTGGCGG Tax3 CCATCTCCCGCTCAGTAAGATACCCCTGCTGTTGGCGG Tax4...")